Torrent Browser Analysis Report Guide

Run Name

Name of the sequencing run entered. This value is typically entered on the Ion S5, Ion PGM, or Ion Proton sequencer.

Run Date

Date and time the PGM or Proton run was started.

Analysis Name

Name of the analysis provided in Torrent Browser when the analysis was initiated. If the analysis was scheduled to auto-start, this is the default analysis name.

Analysis Date

Date the analysis was performed.

Analysis Cycles

Number of cycles analyzed for this report. Note that this number can differ from the total number of cycles run on the sequencer.

Analysis Flows

Number of nucleotide flows analyzed for this report. Note that this number can differ from the total number of flows occurring on the sequencer.

Project

Name of the project assigned to the run. This is typically assigned on the Ion S5, Ion PGM, or Ion Proton sequencer.

Sample

Name of the sample assigned to the run used to generate this analysis. This is assigned on the Ion S5, Ion PGM, or Ion Proton sequencer.

Library

Name of the library assigned to the run used to generate this analysis. This library name is used to specify the reference genome used for alignment.

PGM

Name of the Ion S5, Ion PGM or Ion Proton sequencer where the run was performed.

Chip Check

A series of tests on reference wells (about 10% of the chip in non-addressable areas) is performed to ensure that the chip is functioning at a basic level. The value of this field is either Passed or Failed .

Chip Type

Type of chip used on the sequencer. Usually, 314, 316, or 318 (for the Ion 314 chip, Ion 316 chip, and Ion 318 chip.) A letter follows the numbers, indicating the chip version.

Barcode Set

The name of the barcode set assigned to the run.Blank for non-barcode libraries.

Notes

A space for text notes entered during the Ion S5, Ion PGM, or Ion Proton sequencer run.

Flow Order

Flow order selected on PGM or Proton sequencer:



Samba = TACGTACGTCTGAGCATCGATCGATGTACAGC [Default]

Regular = TACG



The "regular" flow order adds bases most rapidly to sequenced molecules but is vulnerable to phase errors. The Samba flow order consists of a 32-base sequence, repeated. This flow order resists phase errors by providing opportunities for out-of-phase molecules to catch up and is designed to sample all dimer (nucleotide pair) sequences, efficiently. Samba is the default flow order because itimproves sequencing accuracy for longer reads by resisting phase errors.

Library Key

A short known sequence of bases used to distinguish the library fragment from the Test Fragment.Example: "TCAG"

Torrent Suite

Version of Torrent Suite Software software used to generate the analysis.

Datacollect

Version of the Datacollect package.

LiveView

Version of the LiveView package.

Script

Version of the Script package.

ion-alignment

Version of the Torrent Suite Software alignment module used for this analysis.

ion-analysis

Version of the Analysis Pipeline used to generate the analysis.

ion-db reports

Version of the ion-dbreports package.

ion-gpu

Version of the NVIDIA Tesla GPU driver.

ion-plugins

Version of the pre-installed plugins.

ion-torrentR

Version of the TorrentR stats package.

tmap

Version of the TMAP alignment package.