Torrent Browser Analysis Report Guide

Torrent Suite Software space on Ion Community

Report Information

This section describes the following run report buttons:

Analysis Details

The Analysis Details report displays the following information:

Parameter	Description
Run Name	Name of the run.
Run Date	Date and time the Ion S5, Ion PGM, or Ion Proton run was started.
Run Cycles	Number of Ion S5, Ion PGM, or Ion Proton cycles analyzed for this report. Note that this number can differ from the total number of cycles run on the sequencer.
Run Flows	Number of Ion S5, Ion PGM, or Ion Proton nucleotide flows analyzed for this report. Note that this number can differ from the total number of flows occurring on the sequencer.
Project	Names of the projects the result set is a member of.
Sample	Name of the sample assigned to the run used to generate this analysis. This is assigned on the Ion S5, Ion PGM, or Ion Proton Sequencer.
Library	Name of the library assigned to the run used to generate this analysis. This library name is used to specify the reference genome used for alignment.
PGM	Name of the Ion S5, Ion PGM, or Ion Proton Sequencer on which the run was performed. This value is typically entered on the sequencer.
Flow Order	Flow order selected on Ion S5, Ion PGM, or Ion Proton S equencer: Samba = `TACGTACGTCTGAGCATCGATCGATGTACAGC` [Default] Regular = `TACG` The "regular" flow order adds bases most rapidly to sequenced molecules but is vulnerable to phase errors. The Samba flow order consists of a 32-base sequence, repeated. This flow order resists phase errors by providing opportunities for out-of-phase molecules to catch up and is designed to sample all dimer (nucleotide pair) sequences, efficiently. Samba is the default flow order because itimprove sequencing accuracy for longer reads by resisting phase errors.
Library Key	A short known sequence of bases used to distinguish the library fragment from the test fragment.Example: "TCAG"
TF Key	A short known sequence of bases used to distinguish the test fragment.
Chip Check	A series of tests on reference wells (about 10% of the chip in non-addressable areas) is performed to ensure that the chip is functioning at a basic level. The value of this field is either Passed or Failed .
Chip Type	Type of chip used on the Ion PGM Sequencer . Usually, 314, 316, or 318 (for the Ion 314 chip, Ion 316 chip, and Ion 318 chip.) A letter follows the numbers, indicating the chip version.
Chip Data	In this release, the value is single , for a forward run.
Notes	A space for text notes entered during the Ion S5, Ion PGM, or Ion Proton S equencer run.
Barcode Set	The name of the barcode set assigned to the run.Blank for non-barcode libraries.
Analysis Name	Name of the analysis provided in Torrent Browser when the analysis was initiated. If the analysis was scheduled to auto-start, this is the default analysis name.
Analysis Date	Date the analysis was performed.
Analysis Flows	Number of Ion S5, Ion PGM, or Ion Proton nucleotide flows analyzed for this report. Note that this number can differ from the total number of flows occurring on the Ion PGM or Ion Proton S equencer .
runID	The run code that the Torrent Browser assigned to the planned run for this analysis.

Software Version

The Software Version report display includes version information for Torrent Suite Software and its modules installed on your Torrent Server.

Icon

The version numbers shown in the example may be different from your current version of the software depending on the age of the analysis. See the About tab in the Torrent Browser for a complete list of modules and version on your server. See the Torrent Suite Software Release Notes for the package versions in a specific release.

Parameter	Description
Torrent Suite	Version of Torrent Suite Software used to generate the analysis.
Datacollect	Version of the Datacollect package.
Graphics	Version of the Graphics package
LiveView	Version of the LiveView package.
Script	Version of the Script package.
host	Host name where the Torrent Server is installed.
ion-alignment	Version of the Torrent Suite Software alignment module used for this analysis.
ion-analysis	Version of the Analysis Pipeline used to generate the analysis.
ion-gpu	Version of the NVIDIA Tesla GPU driver.
ion-pipeline	Version of the analysis pipeline.

Support

The Support button opens links to the following:

Download the Customer Support Archive Download a ZIP archive containing the PDF and HTML version of the run report as well as useful logs in case troubleshooting is required. See Customer Support Archive for a description of the archive and its contents.
Download the New Customer Support Archive Generate a new customer support archive and download it.
View the Report Log View the error log for this run report.

An example report log is shown below (chopped for width considerations):

Contents

Torrent Browser Analysis Report Guide

Run Report Metrics

Run Metrics Overview

Run Report Metrics Before Alignment

Run Report Metrics on Aligned Reads

Compare Multiple Run Reports

Barcode Reports

Test Fragment Report

Report Information

Output Files

Plugin Summary

Run the Installed Plugins

Assembler SPAdes Plugin

Coverage Analysis Plugin

ERCC Analysis Plugin

FileExporter Plugin

FilterDuplicates Plugin

IonReporterUploader Plugin

See The Ion Reporter™ Software Integration Guide

Run RecognitION Plugin

SampleID Plugin

TorrentSuiteCloud Plugin

Torrent Variant Caller Plugin

Torrent Variant Caller Parameters

Example Torrent Variant Caller Parameter File

Torrent Variant Caller Output

The Command-Line Torrent Variant Caller

Ion Reporter™ Software Features Related to Variant Calling

Integration with TaqMan® and PCR

Classic Run Reports